Review



bp502424  (AMS Biotechnology)


Bioz Verified Symbol AMS Biotechnology is a verified supplier
Bioz Manufacturer Symbol AMS Biotechnology manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    AMS Biotechnology bp502424
    Bp502424, supplied by AMS Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bp502424/BioPORTER+Protein+Delivery+Reagent+QuikEase+Kit/pm32220302-566-20-17
    Average 96 stars, based on 6 article reviews
    bp502424 - by Bioz Stars, 2026-10
    96/100 stars

    Images

    Related Articles

    other:

    Article Title: Structure and Function of the Bacterial Protein Toxin Phenomycin.
    Article Snippet: Intracellular delivery of phenomycin into living cells was performed using the BioPORTER Protein Delivery Reagent QuickEase Kit (AMSBiotechnology (Europe), Cat#: BP502424).

    Virus:

    Article Title: Structure and Function of the Bacterial Protein Toxin Phenomycin.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and Virus Strains DH5a NEB Cat# C2989K BL21 (DE3) NEB Cat# C2527I LOBSTER Andersen et al., 2013 N/A Biological samples Cell pellet from Thermus Thermophilus HB27 BFF, Athens-Gerorgia, USA https://bcmb.franklin.uga.edu/bff N/A Wheat germ Sigma Aldrich Cat# W0125 Chemicals, Peptides, and Recombinant Proteins HisTrapTM Excel column GE Healthcare Cat# GE17-3712-05 Amicon Ultra-4 spin columns Sigma Aldrich Cat# UFC800308 C4 column Vydac Cat# 214TP510 SA matrix Bruker Cat# 8201345 Tris(3- hydroxypropyltriazolylmethyl)amine (THPTA) Sigma Aldrich Cat# 762342 Sulpho-Cy5 azide Lumiprobe Cat# A3330 FAM-azide Lumiprobe Cat# C4130 Azide-PEG3-biotin Sigma Aldrich Cat# 762024 (+)-Sodium L-ascorbate Sigma Aldrich Cat# A7631 Nunc Lab-Tek 8-well chambered coverglass Thermo Scientific Cat# 145411 Poly-D-lysine hydrobromide Sigma Aldrich Cat# P7405 Hoechst 33342 Thermo Scientific Cat# 62249 Lipofectamine 3000 Reagent Kit Thermo Scientific Cat# L3000001 Transferrin Alexa fluor 555 conjugate Invitrogen Cat# T35352 FBS Gibco Cat# A3160802 Dip and Read Streptavidin sensors FortéBio Cat#18-5019 Zeba Spin Desalting Columns, 7 kDa cut-off Thermo Scientific Cat# 89890 MitoTracker Deep Red Invitrogen Cat# M22426 Wheat-germ agglutinin/Alexa Fluor 555 conjugate Invitrogen Cat# W32464 Concanavalin A/Alexa Fluor 488 conjugate Invitrogen Cat# C11252 Phalloidin/Alexa Fluor 568 Invitrogen Cat# A12380 SYTO 14 green fluorescent nucleic acid stain Invitrogen Cat# S7576 Hoechst 33342 Invitrogen Cat# H3570 Bacterial ribosome This paper N/A Yeast ribosome This paper N/A Human ribosome This paper N/A Plant ribosome This paper N/A Critical Commercial Assays CellTiter Blue Promega Cat# G8080 BioPORTER Protein Delivery Reagent QuickEase Kit AMS Biotechnology (Europe) Cat# BP502424 Deposited Data Morphological profiles and correlation matrix This paper Mendeley Data: https://doi.org/10.17632/ 772b973hhz.1 Phenomycin NMR structure This paper BMRB: 50088 Phenomycin structure This paper PDB: 6TKT (Continued on next page) Structure 28, 1–12.e1–e9, May 5, 2020 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental Models: Cell Lines Human: U2OS cell line (taken from 15-year-old female) ATCC ATCC HTB-96; RRID:CVCL_0042 Human: MCF7 (taken from 69-year-old female) ATCC ATCC HTB-22; RRID:CVCL_0031 Human: PANC-1 (taken from 56-year-old male) Cell Line Services (CLS) CLS 300228; RRID:CVCL_0480 Human: BxPC3 (taken from 61-year-old female) Sigma Sigma 93120816; RRID:CVCL_0186 Human: HCC827 (taken from a 39-year-old female) ATCC ATCC CRL-2868; RRID:CVCL_2063 Human: MDA-MB-231 (taken from a 51-year-old female) Cell Line Services (CLS) CLS 300275; RRID:CVCL_0062 Human: A549 (taken from a 58-year-old male) Sigma Sigma 86012804; RRID:CVCL_0023 Human: SiHa (taken from a 55-year-old female) ATCC ATCC HTB-35; RRID:CVCL_0032 Human: HaCat (taken from a 62-year-old male) Creative Bioarray CSC-C8977H; RRID:CVCL_0038 Mouse: AML12 (taken from male) ATCC ATCC CRL-2254; RRID:CVCL_0140 Human: FreeStyleTM HEK-293F (taken from female embryo) Thermo Thermo R79007; RRID:CVCL_6642 Experimental Models: Organisms, Strains S. Cerevisiae - Dstm1: (strain JD1559) J. Dinman, (University of Maryland) N/A Oligonucleotides Fwd K69A CCTGCAAAGGATGCGAAGAGTGATATG This paper N/A Rev K69A CATATCACTCTTCGCATCCTTGCAGG This paper N/A Fwd M3C phenomycin CTTTATTTTCAGGGCGCCTGTGCGAA TCCAAAGACCATC This paper N/A Rev M3C phenomycin GATGGTCTTTGGATTCGCACAGGCGC CCTGAAAATAAAG This paper N/A Fwd M3C aquimarinamycin CTTTATTTTCAGGGCGCCTGTGGACCC ATTAAGGATCGTGAC This paper N/A Rev M3C aquimarinamycin GATCCTTAATGGGTCCACAGGCGCCCT GAAAATAAAGATTC This paper N/A Fwd M3C carotamycin CTTTATTTTCAGGGCGCCTGTGCTATTA GCGATAATGACTACAACCG This paper N/A Rev M3C carotamycin CATTATCGCTAATAGCACAGGCGCCCTG AAAATAAAGATTCTC This paper N/A Recombinant DNA pETM11 EMBL G€unter Stier GFP-Rab7 Choudhury et al., 2002 Addgene plasmid # 12605 Addgene_12605 KSH_AAA (see Table S3) This paper N/A (Continued on next page) e2 Structure 28, 1–12.e1–e9, May 5, 2020

    Recombinant:

    Article Title: Structure and Function of the Bacterial Protein Toxin Phenomycin.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and Virus Strains DH5a NEB Cat# C2989K BL21 (DE3) NEB Cat# C2527I LOBSTER Andersen et al., 2013 N/A Biological samples Cell pellet from Thermus Thermophilus HB27 BFF, Athens-Gerorgia, USA https://bcmb.franklin.uga.edu/bff N/A Wheat germ Sigma Aldrich Cat# W0125 Chemicals, Peptides, and Recombinant Proteins HisTrapTM Excel column GE Healthcare Cat# GE17-3712-05 Amicon Ultra-4 spin columns Sigma Aldrich Cat# UFC800308 C4 column Vydac Cat# 214TP510 SA matrix Bruker Cat# 8201345 Tris(3- hydroxypropyltriazolylmethyl)amine (THPTA) Sigma Aldrich Cat# 762342 Sulpho-Cy5 azide Lumiprobe Cat# A3330 FAM-azide Lumiprobe Cat# C4130 Azide-PEG3-biotin Sigma Aldrich Cat# 762024 (+)-Sodium L-ascorbate Sigma Aldrich Cat# A7631 Nunc Lab-Tek 8-well chambered coverglass Thermo Scientific Cat# 145411 Poly-D-lysine hydrobromide Sigma Aldrich Cat# P7405 Hoechst 33342 Thermo Scientific Cat# 62249 Lipofectamine 3000 Reagent Kit Thermo Scientific Cat# L3000001 Transferrin Alexa fluor 555 conjugate Invitrogen Cat# T35352 FBS Gibco Cat# A3160802 Dip and Read Streptavidin sensors FortéBio Cat#18-5019 Zeba Spin Desalting Columns, 7 kDa cut-off Thermo Scientific Cat# 89890 MitoTracker Deep Red Invitrogen Cat# M22426 Wheat-germ agglutinin/Alexa Fluor 555 conjugate Invitrogen Cat# W32464 Concanavalin A/Alexa Fluor 488 conjugate Invitrogen Cat# C11252 Phalloidin/Alexa Fluor 568 Invitrogen Cat# A12380 SYTO 14 green fluorescent nucleic acid stain Invitrogen Cat# S7576 Hoechst 33342 Invitrogen Cat# H3570 Bacterial ribosome This paper N/A Yeast ribosome This paper N/A Human ribosome This paper N/A Plant ribosome This paper N/A Critical Commercial Assays CellTiter Blue Promega Cat# G8080 BioPORTER Protein Delivery Reagent QuickEase Kit AMS Biotechnology (Europe) Cat# BP502424 Deposited Data Morphological profiles and correlation matrix This paper Mendeley Data: https://doi.org/10.17632/ 772b973hhz.1 Phenomycin NMR structure This paper BMRB: 50088 Phenomycin structure This paper PDB: 6TKT (Continued on next page) Structure 28, 1–12.e1–e9, May 5, 2020 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental Models: Cell Lines Human: U2OS cell line (taken from 15-year-old female) ATCC ATCC HTB-96; RRID:CVCL_0042 Human: MCF7 (taken from 69-year-old female) ATCC ATCC HTB-22; RRID:CVCL_0031 Human: PANC-1 (taken from 56-year-old male) Cell Line Services (CLS) CLS 300228; RRID:CVCL_0480 Human: BxPC3 (taken from 61-year-old female) Sigma Sigma 93120816; RRID:CVCL_0186 Human: HCC827 (taken from a 39-year-old female) ATCC ATCC CRL-2868; RRID:CVCL_2063 Human: MDA-MB-231 (taken from a 51-year-old female) Cell Line Services (CLS) CLS 300275; RRID:CVCL_0062 Human: A549 (taken from a 58-year-old male) Sigma Sigma 86012804; RRID:CVCL_0023 Human: SiHa (taken from a 55-year-old female) ATCC ATCC HTB-35; RRID:CVCL_0032 Human: HaCat (taken from a 62-year-old male) Creative Bioarray CSC-C8977H; RRID:CVCL_0038 Mouse: AML12 (taken from male) ATCC ATCC CRL-2254; RRID:CVCL_0140 Human: FreeStyleTM HEK-293F (taken from female embryo) Thermo Thermo R79007; RRID:CVCL_6642 Experimental Models: Organisms, Strains S. Cerevisiae - Dstm1: (strain JD1559) J. Dinman, (University of Maryland) N/A Oligonucleotides Fwd K69A CCTGCAAAGGATGCGAAGAGTGATATG This paper N/A Rev K69A CATATCACTCTTCGCATCCTTGCAGG This paper N/A Fwd M3C phenomycin CTTTATTTTCAGGGCGCCTGTGCGAA TCCAAAGACCATC This paper N/A Rev M3C phenomycin GATGGTCTTTGGATTCGCACAGGCGC CCTGAAAATAAAG This paper N/A Fwd M3C aquimarinamycin CTTTATTTTCAGGGCGCCTGTGGACCC ATTAAGGATCGTGAC This paper N/A Rev M3C aquimarinamycin GATCCTTAATGGGTCCACAGGCGCCCT GAAAATAAAGATTC This paper N/A Fwd M3C carotamycin CTTTATTTTCAGGGCGCCTGTGCTATTA GCGATAATGACTACAACCG This paper N/A Rev M3C carotamycin CATTATCGCTAATAGCACAGGCGCCCTG AAAATAAAGATTCTC This paper N/A Recombinant DNA pETM11 EMBL G€unter Stier GFP-Rab7 Choudhury et al., 2002 Addgene plasmid # 12605 Addgene_12605 KSH_AAA (see Table S3) This paper N/A (Continued on next page) e2 Structure 28, 1–12.e1–e9, May 5, 2020

    Staining:

    Article Title: Structure and Function of the Bacterial Protein Toxin Phenomycin.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and Virus Strains DH5a NEB Cat# C2989K BL21 (DE3) NEB Cat# C2527I LOBSTER Andersen et al., 2013 N/A Biological samples Cell pellet from Thermus Thermophilus HB27 BFF, Athens-Gerorgia, USA https://bcmb.franklin.uga.edu/bff N/A Wheat germ Sigma Aldrich Cat# W0125 Chemicals, Peptides, and Recombinant Proteins HisTrapTM Excel column GE Healthcare Cat# GE17-3712-05 Amicon Ultra-4 spin columns Sigma Aldrich Cat# UFC800308 C4 column Vydac Cat# 214TP510 SA matrix Bruker Cat# 8201345 Tris(3- hydroxypropyltriazolylmethyl)amine (THPTA) Sigma Aldrich Cat# 762342 Sulpho-Cy5 azide Lumiprobe Cat# A3330 FAM-azide Lumiprobe Cat# C4130 Azide-PEG3-biotin Sigma Aldrich Cat# 762024 (+)-Sodium L-ascorbate Sigma Aldrich Cat# A7631 Nunc Lab-Tek 8-well chambered coverglass Thermo Scientific Cat# 145411 Poly-D-lysine hydrobromide Sigma Aldrich Cat# P7405 Hoechst 33342 Thermo Scientific Cat# 62249 Lipofectamine 3000 Reagent Kit Thermo Scientific Cat# L3000001 Transferrin Alexa fluor 555 conjugate Invitrogen Cat# T35352 FBS Gibco Cat# A3160802 Dip and Read Streptavidin sensors FortéBio Cat#18-5019 Zeba Spin Desalting Columns, 7 kDa cut-off Thermo Scientific Cat# 89890 MitoTracker Deep Red Invitrogen Cat# M22426 Wheat-germ agglutinin/Alexa Fluor 555 conjugate Invitrogen Cat# W32464 Concanavalin A/Alexa Fluor 488 conjugate Invitrogen Cat# C11252 Phalloidin/Alexa Fluor 568 Invitrogen Cat# A12380 SYTO 14 green fluorescent nucleic acid stain Invitrogen Cat# S7576 Hoechst 33342 Invitrogen Cat# H3570 Bacterial ribosome This paper N/A Yeast ribosome This paper N/A Human ribosome This paper N/A Plant ribosome This paper N/A Critical Commercial Assays CellTiter Blue Promega Cat# G8080 BioPORTER Protein Delivery Reagent QuickEase Kit AMS Biotechnology (Europe) Cat# BP502424 Deposited Data Morphological profiles and correlation matrix This paper Mendeley Data: https://doi.org/10.17632/ 772b973hhz.1 Phenomycin NMR structure This paper BMRB: 50088 Phenomycin structure This paper PDB: 6TKT (Continued on next page) Structure 28, 1–12.e1–e9, May 5, 2020 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental Models: Cell Lines Human: U2OS cell line (taken from 15-year-old female) ATCC ATCC HTB-96; RRID:CVCL_0042 Human: MCF7 (taken from 69-year-old female) ATCC ATCC HTB-22; RRID:CVCL_0031 Human: PANC-1 (taken from 56-year-old male) Cell Line Services (CLS) CLS 300228; RRID:CVCL_0480 Human: BxPC3 (taken from 61-year-old female) Sigma Sigma 93120816; RRID:CVCL_0186 Human: HCC827 (taken from a 39-year-old female) ATCC ATCC CRL-2868; RRID:CVCL_2063 Human: MDA-MB-231 (taken from a 51-year-old female) Cell Line Services (CLS) CLS 300275; RRID:CVCL_0062 Human: A549 (taken from a 58-year-old male) Sigma Sigma 86012804; RRID:CVCL_0023 Human: SiHa (taken from a 55-year-old female) ATCC ATCC HTB-35; RRID:CVCL_0032 Human: HaCat (taken from a 62-year-old male) Creative Bioarray CSC-C8977H; RRID:CVCL_0038 Mouse: AML12 (taken from male) ATCC ATCC CRL-2254; RRID:CVCL_0140 Human: FreeStyleTM HEK-293F (taken from female embryo) Thermo Thermo R79007; RRID:CVCL_6642 Experimental Models: Organisms, Strains S. Cerevisiae - Dstm1: (strain JD1559) J. Dinman, (University of Maryland) N/A Oligonucleotides Fwd K69A CCTGCAAAGGATGCGAAGAGTGATATG This paper N/A Rev K69A CATATCACTCTTCGCATCCTTGCAGG This paper N/A Fwd M3C phenomycin CTTTATTTTCAGGGCGCCTGTGCGAA TCCAAAGACCATC This paper N/A Rev M3C phenomycin GATGGTCTTTGGATTCGCACAGGCGC CCTGAAAATAAAG This paper N/A Fwd M3C aquimarinamycin CTTTATTTTCAGGGCGCCTGTGGACCC ATTAAGGATCGTGAC This paper N/A Rev M3C aquimarinamycin GATCCTTAATGGGTCCACAGGCGCCCT GAAAATAAAGATTC This paper N/A Fwd M3C carotamycin CTTTATTTTCAGGGCGCCTGTGCTATTA GCGATAATGACTACAACCG This paper N/A Rev M3C carotamycin CATTATCGCTAATAGCACAGGCGCCCTG AAAATAAAGATTCTC This paper N/A Recombinant DNA pETM11 EMBL G€unter Stier GFP-Rab7 Choudhury et al., 2002 Addgene plasmid # 12605 Addgene_12605 KSH_AAA (see Table S3) This paper N/A (Continued on next page) e2 Structure 28, 1–12.e1–e9, May 5, 2020

    Nuclear Magnetic Resonance:

    Article Title: Structure and Function of the Bacterial Protein Toxin Phenomycin.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and Virus Strains DH5a NEB Cat# C2989K BL21 (DE3) NEB Cat# C2527I LOBSTER Andersen et al., 2013 N/A Biological samples Cell pellet from Thermus Thermophilus HB27 BFF, Athens-Gerorgia, USA https://bcmb.franklin.uga.edu/bff N/A Wheat germ Sigma Aldrich Cat# W0125 Chemicals, Peptides, and Recombinant Proteins HisTrapTM Excel column GE Healthcare Cat# GE17-3712-05 Amicon Ultra-4 spin columns Sigma Aldrich Cat# UFC800308 C4 column Vydac Cat# 214TP510 SA matrix Bruker Cat# 8201345 Tris(3- hydroxypropyltriazolylmethyl)amine (THPTA) Sigma Aldrich Cat# 762342 Sulpho-Cy5 azide Lumiprobe Cat# A3330 FAM-azide Lumiprobe Cat# C4130 Azide-PEG3-biotin Sigma Aldrich Cat# 762024 (+)-Sodium L-ascorbate Sigma Aldrich Cat# A7631 Nunc Lab-Tek 8-well chambered coverglass Thermo Scientific Cat# 145411 Poly-D-lysine hydrobromide Sigma Aldrich Cat# P7405 Hoechst 33342 Thermo Scientific Cat# 62249 Lipofectamine 3000 Reagent Kit Thermo Scientific Cat# L3000001 Transferrin Alexa fluor 555 conjugate Invitrogen Cat# T35352 FBS Gibco Cat# A3160802 Dip and Read Streptavidin sensors FortéBio Cat#18-5019 Zeba Spin Desalting Columns, 7 kDa cut-off Thermo Scientific Cat# 89890 MitoTracker Deep Red Invitrogen Cat# M22426 Wheat-germ agglutinin/Alexa Fluor 555 conjugate Invitrogen Cat# W32464 Concanavalin A/Alexa Fluor 488 conjugate Invitrogen Cat# C11252 Phalloidin/Alexa Fluor 568 Invitrogen Cat# A12380 SYTO 14 green fluorescent nucleic acid stain Invitrogen Cat# S7576 Hoechst 33342 Invitrogen Cat# H3570 Bacterial ribosome This paper N/A Yeast ribosome This paper N/A Human ribosome This paper N/A Plant ribosome This paper N/A Critical Commercial Assays CellTiter Blue Promega Cat# G8080 BioPORTER Protein Delivery Reagent QuickEase Kit AMS Biotechnology (Europe) Cat# BP502424 Deposited Data Morphological profiles and correlation matrix This paper Mendeley Data: https://doi.org/10.17632/ 772b973hhz.1 Phenomycin NMR structure This paper BMRB: 50088 Phenomycin structure This paper PDB: 6TKT (Continued on next page) Structure 28, 1–12.e1–e9, May 5, 2020 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental Models: Cell Lines Human: U2OS cell line (taken from 15-year-old female) ATCC ATCC HTB-96; RRID:CVCL_0042 Human: MCF7 (taken from 69-year-old female) ATCC ATCC HTB-22; RRID:CVCL_0031 Human: PANC-1 (taken from 56-year-old male) Cell Line Services (CLS) CLS 300228; RRID:CVCL_0480 Human: BxPC3 (taken from 61-year-old female) Sigma Sigma 93120816; RRID:CVCL_0186 Human: HCC827 (taken from a 39-year-old female) ATCC ATCC CRL-2868; RRID:CVCL_2063 Human: MDA-MB-231 (taken from a 51-year-old female) Cell Line Services (CLS) CLS 300275; RRID:CVCL_0062 Human: A549 (taken from a 58-year-old male) Sigma Sigma 86012804; RRID:CVCL_0023 Human: SiHa (taken from a 55-year-old female) ATCC ATCC HTB-35; RRID:CVCL_0032 Human: HaCat (taken from a 62-year-old male) Creative Bioarray CSC-C8977H; RRID:CVCL_0038 Mouse: AML12 (taken from male) ATCC ATCC CRL-2254; RRID:CVCL_0140 Human: FreeStyleTM HEK-293F (taken from female embryo) Thermo Thermo R79007; RRID:CVCL_6642 Experimental Models: Organisms, Strains S. Cerevisiae - Dstm1: (strain JD1559) J. Dinman, (University of Maryland) N/A Oligonucleotides Fwd K69A CCTGCAAAGGATGCGAAGAGTGATATG This paper N/A Rev K69A CATATCACTCTTCGCATCCTTGCAGG This paper N/A Fwd M3C phenomycin CTTTATTTTCAGGGCGCCTGTGCGAA TCCAAAGACCATC This paper N/A Rev M3C phenomycin GATGGTCTTTGGATTCGCACAGGCGC CCTGAAAATAAAG This paper N/A Fwd M3C aquimarinamycin CTTTATTTTCAGGGCGCCTGTGGACCC ATTAAGGATCGTGAC This paper N/A Rev M3C aquimarinamycin GATCCTTAATGGGTCCACAGGCGCCCT GAAAATAAAGATTC This paper N/A Fwd M3C carotamycin CTTTATTTTCAGGGCGCCTGTGCTATTA GCGATAATGACTACAACCG This paper N/A Rev M3C carotamycin CATTATCGCTAATAGCACAGGCGCCCTG AAAATAAAGATTCTC This paper N/A Recombinant DNA pETM11 EMBL G€unter Stier GFP-Rab7 Choudhury et al., 2002 Addgene plasmid # 12605 Addgene_12605 KSH_AAA (see Table S3) This paper N/A (Continued on next page) e2 Structure 28, 1–12.e1–e9, May 5, 2020



    Similar Products

    bp502424  (AMS Biotechnology)
    96
    AMS Biotechnology bp502424
    Bp502424, supplied by AMS Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bp502424/BioPORTER+Protein+Delivery+Reagent+QuikEase+Kit/pm32220302-566-20-17
    Average 96 stars, based on 1 article reviews
    bp502424 - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    protein delivery reagent  (Genlantis inc)
    92
    Genlantis inc protein delivery reagent
    Protein Delivery Reagent, supplied by Genlantis inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bp502424/pm37248338-449-15-19
    Average 92 stars, based on 1 article reviews
    protein delivery reagent - by Bioz Stars, 2026-10
    92/100 stars
    		  Buy from Supplier
    bioporter  (Genlantis inc)
    92
    Genlantis inc bioporter
    Bioporter, supplied by Genlantis inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bp502424/pm33971027-38-62-69
    Average 92 stars, based on 1 article reviews
    bioporter - by Bioz Stars, 2026-10
    92/100 stars
    		  Buy from Supplier
    bioporter protein delivery agent bp502424  (Gelantis Inc)
    90
    Gelantis Inc bioporter protein delivery agent bp502424
    Bioporter Protein Delivery Agent Bp502424, supplied by Gelantis Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bp502424/geneporter+2/pmc07383368-131-8-16
    Average 90 stars, based on 1 article reviews
    bioporter protein delivery agent bp502424 - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    quikease kit  (Genlantis inc)
    92
    Genlantis inc quikease kit
    Quikease Kit, supplied by Genlantis inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bp502424/bio_rxiv__2020__04__08__032250-179-4-6
    Average 92 stars, based on 1 article reviews
    quikease kit - by Bioz Stars, 2026-10
    92/100 stars
    		  Buy from Supplier

    Image Search Results